ID: 1059827928

View in Genome Browser
Species Human (GRCh38)
Location 9:118053336-118053358
Sequence GTGAACAACCAGAATGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059827928_1059827931 25 Left 1059827928 9:118053336-118053358 CCAATCTCATTCTGGTTGTTCAC No data
Right 1059827931 9:118053384-118053406 AACTGAGGTCCCAGTGTACTTGG No data
1059827928_1059827929 10 Left 1059827928 9:118053336-118053358 CCAATCTCATTCTGGTTGTTCAC No data
Right 1059827929 9:118053369-118053391 TCCTTGTATTTGTAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059827928 Original CRISPR GTGAACAACCAGAATGAGAT TGG (reversed) Intergenic
No off target data available for this crispr