ID: 1059837847

View in Genome Browser
Species Human (GRCh38)
Location 9:118177372-118177394
Sequence CTAACTCTTTTTAAACCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059837847_1059837853 12 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837853 9:118177407-118177429 CTCATATAACATTCTAGGGGTGG No data
1059837847_1059837856 29 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837856 9:118177424-118177446 GGGTGGGTTTATGGATGTATTGG No data
1059837847_1059837857 30 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837857 9:118177425-118177447 GGTGGGTTTATGGATGTATTGGG No data
1059837847_1059837849 7 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837849 9:118177402-118177424 CCAGCCTCATATAACATTCTAGG No data
1059837847_1059837854 13 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837854 9:118177408-118177430 TCATATAACATTCTAGGGGTGGG No data
1059837847_1059837850 8 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837850 9:118177403-118177425 CAGCCTCATATAACATTCTAGGG No data
1059837847_1059837851 9 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837851 9:118177404-118177426 AGCCTCATATAACATTCTAGGGG No data
1059837847_1059837855 20 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837855 9:118177415-118177437 ACATTCTAGGGGTGGGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059837847 Original CRISPR CTAACTCTTTTTAAACCACA AGG (reversed) Intergenic
No off target data available for this crispr