ID: 1059837853

View in Genome Browser
Species Human (GRCh38)
Location 9:118177407-118177429
Sequence CTCATATAACATTCTAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059837847_1059837853 12 Left 1059837847 9:118177372-118177394 CCTTGTGGTTTAAAAAGAGTTAG No data
Right 1059837853 9:118177407-118177429 CTCATATAACATTCTAGGGGTGG No data
1059837846_1059837853 13 Left 1059837846 9:118177371-118177393 CCCTTGTGGTTTAAAAAGAGTTA No data
Right 1059837853 9:118177407-118177429 CTCATATAACATTCTAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059837853 Original CRISPR CTCATATAACATTCTAGGGG TGG Intergenic
No off target data available for this crispr