ID: 1059838968

View in Genome Browser
Species Human (GRCh38)
Location 9:118191200-118191222
Sequence AGAGAGAGTACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059838965_1059838968 14 Left 1059838965 9:118191163-118191185 CCACATGTCACAGAGAGAGAATC No data
Right 1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG No data
1059838962_1059838968 26 Left 1059838962 9:118191151-118191173 CCCCTGCAGTGACCACATGTCAC No data
Right 1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG No data
1059838963_1059838968 25 Left 1059838963 9:118191152-118191174 CCCTGCAGTGACCACATGTCACA No data
Right 1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG No data
1059838961_1059838968 30 Left 1059838961 9:118191147-118191169 CCGACCCCTGCAGTGACCACATG No data
Right 1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG No data
1059838964_1059838968 24 Left 1059838964 9:118191153-118191175 CCTGCAGTGACCACATGTCACAG No data
Right 1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059838968 Original CRISPR AGAGAGAGTACAGTGATTGT GGG Intergenic
No off target data available for this crispr