ID: 1059843879

View in Genome Browser
Species Human (GRCh38)
Location 9:118249331-118249353
Sequence ATGACCTTGAATACAACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059843878_1059843879 -5 Left 1059843878 9:118249313-118249335 CCTTTTATTCTCACTTGAATGAC No data
Right 1059843879 9:118249331-118249353 ATGACCTTGAATACAACTTCTGG No data
1059843877_1059843879 -1 Left 1059843877 9:118249309-118249331 CCTGCCTTTTATTCTCACTTGAA No data
Right 1059843879 9:118249331-118249353 ATGACCTTGAATACAACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059843879 Original CRISPR ATGACCTTGAATACAACTTC TGG Intergenic
No off target data available for this crispr