ID: 1059845773

View in Genome Browser
Species Human (GRCh38)
Location 9:118274935-118274957
Sequence ATACCTTGGAAGCCTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059845773_1059845780 25 Left 1059845773 9:118274935-118274957 CCTTCAGGAGGCTTCCAAGGTAT No data
Right 1059845780 9:118274983-118275005 CCCAAGATACAGAGTAAAAATGG No data
1059845773_1059845782 29 Left 1059845773 9:118274935-118274957 CCTTCAGGAGGCTTCCAAGGTAT No data
Right 1059845782 9:118274987-118275009 AGATACAGAGTAAAAATGGTAGG No data
1059845773_1059845777 -7 Left 1059845773 9:118274935-118274957 CCTTCAGGAGGCTTCCAAGGTAT No data
Right 1059845777 9:118274951-118274973 AAGGTATTCCAAGAAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059845773 Original CRISPR ATACCTTGGAAGCCTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr