ID: 1059856426

View in Genome Browser
Species Human (GRCh38)
Location 9:118403228-118403250
Sequence CTGCTCTGACAGCTTATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059856426_1059856430 0 Left 1059856426 9:118403228-118403250 CCCTGCATAAGCTGTCAGAGCAG No data
Right 1059856430 9:118403251-118403273 ACAATTGCCTGGATGGATGATGG No data
1059856426_1059856429 -7 Left 1059856426 9:118403228-118403250 CCCTGCATAAGCTGTCAGAGCAG No data
Right 1059856429 9:118403244-118403266 AGAGCAGACAATTGCCTGGATGG No data
1059856426_1059856431 4 Left 1059856426 9:118403228-118403250 CCCTGCATAAGCTGTCAGAGCAG No data
Right 1059856431 9:118403255-118403277 TTGCCTGGATGGATGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059856426 Original CRISPR CTGCTCTGACAGCTTATGCA GGG (reversed) Intergenic
No off target data available for this crispr