ID: 1059859376

View in Genome Browser
Species Human (GRCh38)
Location 9:118441491-118441513
Sequence AGATGCAAAGAGCAGTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059859376_1059859379 11 Left 1059859376 9:118441491-118441513 CCCTAACACTGCTCTTTGCATCT No data
Right 1059859379 9:118441525-118441547 TACTCCAAGAGCCTAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059859376 Original CRISPR AGATGCAAAGAGCAGTGTTA GGG (reversed) Intergenic
No off target data available for this crispr