ID: 1059860677

View in Genome Browser
Species Human (GRCh38)
Location 9:118457579-118457601
Sequence CCCTCTAGTCATGCACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059860677_1059860685 14 Left 1059860677 9:118457579-118457601 CCCTCCAGTGCATGACTAGAGGG No data
Right 1059860685 9:118457616-118457638 TAAATGAGAACTTTACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059860677 Original CRISPR CCCTCTAGTCATGCACTGGA GGG (reversed) Intergenic
No off target data available for this crispr