ID: 1059860868

View in Genome Browser
Species Human (GRCh38)
Location 9:118460002-118460024
Sequence TGTCCTCTATGATTTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059860866_1059860868 -3 Left 1059860866 9:118459982-118460004 CCATATATGGCATCAGATGATGT No data
Right 1059860868 9:118460002-118460024 TGTCCTCTATGATTTCCTGGAGG No data
1059860863_1059860868 11 Left 1059860863 9:118459968-118459990 CCTCCAGAATGGTGCCATATATG No data
Right 1059860868 9:118460002-118460024 TGTCCTCTATGATTTCCTGGAGG No data
1059860865_1059860868 8 Left 1059860865 9:118459971-118459993 CCAGAATGGTGCCATATATGGCA No data
Right 1059860868 9:118460002-118460024 TGTCCTCTATGATTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059860868 Original CRISPR TGTCCTCTATGATTTCCTGG AGG Intergenic
No off target data available for this crispr