ID: 1059861027

View in Genome Browser
Species Human (GRCh38)
Location 9:118461981-118462003
Sequence GAGTATTGCTATAAGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059861027_1059861031 24 Left 1059861027 9:118461981-118462003 CCATCACTCTTATAGCAATACTC No data
Right 1059861031 9:118462028-118462050 AAGGTTGACGTCAACATAAATGG No data
1059861027_1059861030 5 Left 1059861027 9:118461981-118462003 CCATCACTCTTATAGCAATACTC No data
Right 1059861030 9:118462009-118462031 TACTGGAGTTAGCAAGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059861027 Original CRISPR GAGTATTGCTATAAGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr