ID: 1059870701

View in Genome Browser
Species Human (GRCh38)
Location 9:118570929-118570951
Sequence ATTTTTGCAGAGATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059870701_1059870704 -5 Left 1059870701 9:118570929-118570951 CCAGGCTCCATCTCTGCAAAAAT No data
Right 1059870704 9:118570947-118570969 AAAATATACAAAAATTAGCTGGG 0: 233
1: 9336
2: 93229
3: 178141
4: 130608
1059870701_1059870703 -6 Left 1059870701 9:118570929-118570951 CCAGGCTCCATCTCTGCAAAAAT No data
Right 1059870703 9:118570946-118570968 AAAAATATACAAAAATTAGCTGG 0: 130
1: 4834
2: 32872
3: 131463
4: 99948

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059870701 Original CRISPR ATTTTTGCAGAGATGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr