ID: 1059874271

View in Genome Browser
Species Human (GRCh38)
Location 9:118616733-118616755
Sequence AATGGGTAAAGCAGAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059874271_1059874278 -3 Left 1059874271 9:118616733-118616755 CCATTTTCTCTGCTTTACCCATT No data
Right 1059874278 9:118616753-118616775 ATTCTATTTAGGTAACCTGGGGG No data
1059874271_1059874281 14 Left 1059874271 9:118616733-118616755 CCATTTTCTCTGCTTTACCCATT No data
Right 1059874281 9:118616770-118616792 TGGGGGGTATAGTTTAAAACTGG No data
1059874271_1059874279 -2 Left 1059874271 9:118616733-118616755 CCATTTTCTCTGCTTTACCCATT No data
Right 1059874279 9:118616754-118616776 TTCTATTTAGGTAACCTGGGGGG No data
1059874271_1059874276 -5 Left 1059874271 9:118616733-118616755 CCATTTTCTCTGCTTTACCCATT No data
Right 1059874276 9:118616751-118616773 CCATTCTATTTAGGTAACCTGGG No data
1059874271_1059874277 -4 Left 1059874271 9:118616733-118616755 CCATTTTCTCTGCTTTACCCATT No data
Right 1059874277 9:118616752-118616774 CATTCTATTTAGGTAACCTGGGG No data
1059874271_1059874274 -6 Left 1059874271 9:118616733-118616755 CCATTTTCTCTGCTTTACCCATT No data
Right 1059874274 9:118616750-118616772 CCCATTCTATTTAGGTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059874271 Original CRISPR AATGGGTAAAGCAGAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr