ID: 1059874279

View in Genome Browser
Species Human (GRCh38)
Location 9:118616754-118616776
Sequence TTCTATTTAGGTAACCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059874271_1059874279 -2 Left 1059874271 9:118616733-118616755 CCATTTTCTCTGCTTTACCCATT No data
Right 1059874279 9:118616754-118616776 TTCTATTTAGGTAACCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059874279 Original CRISPR TTCTATTTAGGTAACCTGGG GGG Intergenic
No off target data available for this crispr