ID: 1059876694

View in Genome Browser
Species Human (GRCh38)
Location 9:118643304-118643326
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876694_1059876700 5 Left 1059876694 9:118643304-118643326 CCTCTGGAATGCCAAGTGACCAC No data
Right 1059876700 9:118643332-118643354 CCTGCTTGTGGAATGTAGAGTGG No data
1059876694_1059876696 -7 Left 1059876694 9:118643304-118643326 CCTCTGGAATGCCAAGTGACCAC No data
Right 1059876696 9:118643320-118643342 TGACCACAGCTCCCTGCTTGTGG No data
1059876694_1059876701 22 Left 1059876694 9:118643304-118643326 CCTCTGGAATGCCAAGTGACCAC No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876694 Original CRISPR GTGGTCACTTGGCATTCCAG AGG (reversed) Intergenic
No off target data available for this crispr