ID: 1059876695

View in Genome Browser
Species Human (GRCh38)
Location 9:118643315-118643337
Sequence AGCAGGGAGCTGTGGTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876695_1059876706 29 Left 1059876695 9:118643315-118643337 CCAAGTGACCACAGCTCCCTGCT No data
Right 1059876706 9:118643367-118643389 CCAGGTGACCAACAGCTGCATGG No data
1059876695_1059876701 11 Left 1059876695 9:118643315-118643337 CCAAGTGACCACAGCTCCCTGCT No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data
1059876695_1059876700 -6 Left 1059876695 9:118643315-118643337 CCAAGTGACCACAGCTCCCTGCT No data
Right 1059876700 9:118643332-118643354 CCTGCTTGTGGAATGTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876695 Original CRISPR AGCAGGGAGCTGTGGTCACT TGG (reversed) Intergenic
No off target data available for this crispr