ID: 1059876698

View in Genome Browser
Species Human (GRCh38)
Location 9:118643331-118643353
Sequence CACTCTACATTCCACAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876698_1059876701 -5 Left 1059876698 9:118643331-118643353 CCCTGCTTGTGGAATGTAGAGTG No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data
1059876698_1059876707 19 Left 1059876698 9:118643331-118643353 CCCTGCTTGTGGAATGTAGAGTG No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data
1059876698_1059876706 13 Left 1059876698 9:118643331-118643353 CCCTGCTTGTGGAATGTAGAGTG No data
Right 1059876706 9:118643367-118643389 CCAGGTGACCAACAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876698 Original CRISPR CACTCTACATTCCACAAGCA GGG (reversed) Intergenic
No off target data available for this crispr