ID: 1059876701

View in Genome Browser
Species Human (GRCh38)
Location 9:118643349-118643371
Sequence GAGTGGCCCCAGCATTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876697_1059876701 3 Left 1059876697 9:118643323-118643345 CCACAGCTCCCTGCTTGTGGAAT No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data
1059876698_1059876701 -5 Left 1059876698 9:118643331-118643353 CCCTGCTTGTGGAATGTAGAGTG No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data
1059876699_1059876701 -6 Left 1059876699 9:118643332-118643354 CCTGCTTGTGGAATGTAGAGTGG No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data
1059876695_1059876701 11 Left 1059876695 9:118643315-118643337 CCAAGTGACCACAGCTCCCTGCT No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data
1059876694_1059876701 22 Left 1059876694 9:118643304-118643326 CCTCTGGAATGCCAAGTGACCAC No data
Right 1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876701 Original CRISPR GAGTGGCCCCAGCATTAGCC AGG Intergenic
No off target data available for this crispr