ID: 1059876702

View in Genome Browser
Species Human (GRCh38)
Location 9:118643355-118643377
Sequence TGGTCACCTGGCTAATGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876702_1059876707 -5 Left 1059876702 9:118643355-118643377 CCCCAGCATTAGCCAGGTGACCA No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876702 Original CRISPR TGGTCACCTGGCTAATGCTG GGG (reversed) Intergenic
No off target data available for this crispr