ID: 1059876703

View in Genome Browser
Species Human (GRCh38)
Location 9:118643356-118643378
Sequence TTGGTCACCTGGCTAATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876703_1059876707 -6 Left 1059876703 9:118643356-118643378 CCCAGCATTAGCCAGGTGACCAA No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876703 Original CRISPR TTGGTCACCTGGCTAATGCT GGG (reversed) Intergenic
No off target data available for this crispr