ID: 1059876704

View in Genome Browser
Species Human (GRCh38)
Location 9:118643357-118643379
Sequence GTTGGTCACCTGGCTAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876704_1059876707 -7 Left 1059876704 9:118643357-118643379 CCAGCATTAGCCAGGTGACCAAC No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876704 Original CRISPR GTTGGTCACCTGGCTAATGC TGG (reversed) Intergenic
No off target data available for this crispr