ID: 1059876706

View in Genome Browser
Species Human (GRCh38)
Location 9:118643367-118643389
Sequence CCAGGTGACCAACAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876695_1059876706 29 Left 1059876695 9:118643315-118643337 CCAAGTGACCACAGCTCCCTGCT No data
Right 1059876706 9:118643367-118643389 CCAGGTGACCAACAGCTGCATGG No data
1059876697_1059876706 21 Left 1059876697 9:118643323-118643345 CCACAGCTCCCTGCTTGTGGAAT No data
Right 1059876706 9:118643367-118643389 CCAGGTGACCAACAGCTGCATGG No data
1059876699_1059876706 12 Left 1059876699 9:118643332-118643354 CCTGCTTGTGGAATGTAGAGTGG No data
Right 1059876706 9:118643367-118643389 CCAGGTGACCAACAGCTGCATGG No data
1059876698_1059876706 13 Left 1059876698 9:118643331-118643353 CCCTGCTTGTGGAATGTAGAGTG No data
Right 1059876706 9:118643367-118643389 CCAGGTGACCAACAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876706 Original CRISPR CCAGGTGACCAACAGCTGCA TGG Intergenic
No off target data available for this crispr