ID: 1059876707

View in Genome Browser
Species Human (GRCh38)
Location 9:118643373-118643395
Sequence GACCAACAGCTGCATGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059876698_1059876707 19 Left 1059876698 9:118643331-118643353 CCCTGCTTGTGGAATGTAGAGTG No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data
1059876699_1059876707 18 Left 1059876699 9:118643332-118643354 CCTGCTTGTGGAATGTAGAGTGG No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data
1059876703_1059876707 -6 Left 1059876703 9:118643356-118643378 CCCAGCATTAGCCAGGTGACCAA No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data
1059876702_1059876707 -5 Left 1059876702 9:118643355-118643377 CCCCAGCATTAGCCAGGTGACCA No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data
1059876704_1059876707 -7 Left 1059876704 9:118643357-118643379 CCAGCATTAGCCAGGTGACCAAC No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data
1059876697_1059876707 27 Left 1059876697 9:118643323-118643345 CCACAGCTCCCTGCTTGTGGAAT No data
Right 1059876707 9:118643373-118643395 GACCAACAGCTGCATGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059876707 Original CRISPR GACCAACAGCTGCATGGCAT TGG Intergenic
No off target data available for this crispr