ID: 1059878119

View in Genome Browser
Species Human (GRCh38)
Location 9:118658877-118658899
Sequence TCTAAGCTTTATTAGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059878119_1059878120 -6 Left 1059878119 9:118658877-118658899 CCTTAAATCTAATAAAGCTTAGA No data
Right 1059878120 9:118658894-118658916 CTTAGAACTTATGAGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059878119 Original CRISPR TCTAAGCTTTATTAGATTTA AGG (reversed) Intergenic
No off target data available for this crispr