ID: 1059879608

View in Genome Browser
Species Human (GRCh38)
Location 9:118675683-118675705
Sequence AACACCAAGCTGTTACACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059879608_1059879613 24 Left 1059879608 9:118675683-118675705 CCTCTGTGTAACAGCTTGGTGTT No data
Right 1059879613 9:118675730-118675752 GATGCAAATTAGCTTAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059879608 Original CRISPR AACACCAAGCTGTTACACAG AGG (reversed) Intergenic
No off target data available for this crispr