ID: 1059880831

View in Genome Browser
Species Human (GRCh38)
Location 9:118687104-118687126
Sequence ATGGAGTGGCTGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059880831_1059880839 27 Left 1059880831 9:118687104-118687126 CCATCCTGCTTCAGCCACTCCAT No data
Right 1059880839 9:118687154-118687176 CTGTGTTCCAGGAAAGCATCTGG No data
1059880831_1059880835 16 Left 1059880831 9:118687104-118687126 CCATCCTGCTTCAGCCACTCCAT No data
Right 1059880835 9:118687143-118687165 CACTCCTTTCCCTGTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059880831 Original CRISPR ATGGAGTGGCTGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr