ID: 1059884619

View in Genome Browser
Species Human (GRCh38)
Location 9:118731973-118731995
Sequence CACTGGACAAGGACCTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059884619_1059884626 27 Left 1059884619 9:118731973-118731995 CCTGACCAGGTCCTTGTCCAGTG No data
Right 1059884626 9:118732023-118732045 GTCTACTTGATGTGCCGTCTGGG No data
1059884619_1059884625 26 Left 1059884619 9:118731973-118731995 CCTGACCAGGTCCTTGTCCAGTG No data
Right 1059884625 9:118732022-118732044 TGTCTACTTGATGTGCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059884619 Original CRISPR CACTGGACAAGGACCTGGTC AGG (reversed) Intergenic
No off target data available for this crispr