ID: 1059885138

View in Genome Browser
Species Human (GRCh38)
Location 9:118737114-118737136
Sequence CACAGGGATGGAGCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059885131_1059885138 15 Left 1059885131 9:118737076-118737098 CCTGCAAGAGCAGCTGCAAGGGC No data
Right 1059885138 9:118737114-118737136 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059885138 Original CRISPR CACAGGGATGGAGCTGCCCA AGG Intergenic
Too many off-targets to display for this crispr