ID: 1059885964

View in Genome Browser
Species Human (GRCh38)
Location 9:118745032-118745054
Sequence CTGTGCAATCATATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059885962_1059885964 25 Left 1059885962 9:118744984-118745006 CCTAGGACATCTCTGACTGATTA No data
Right 1059885964 9:118745032-118745054 CTGTGCAATCATATGCAGCCTGG No data
1059885961_1059885964 26 Left 1059885961 9:118744983-118745005 CCCTAGGACATCTCTGACTGATT No data
Right 1059885964 9:118745032-118745054 CTGTGCAATCATATGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059885964 Original CRISPR CTGTGCAATCATATGCAGCC TGG Intergenic
No off target data available for this crispr