ID: 1059886566

View in Genome Browser
Species Human (GRCh38)
Location 9:118751080-118751102
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059886560_1059886566 27 Left 1059886560 9:118751030-118751052 CCTCTGGCAACAGCCACATGGCA No data
Right 1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG No data
1059886562_1059886566 14 Left 1059886562 9:118751043-118751065 CCACATGGCATGGAGAGAGAATC No data
Right 1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059886566 Original CRISPR AGGGACAGCACAGTGATTGT GGG Intergenic