ID: 1059890841

View in Genome Browser
Species Human (GRCh38)
Location 9:118801816-118801838
Sequence TTATGTAGCAGCCTTCGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059890841_1059890843 0 Left 1059890841 9:118801816-118801838 CCTATACGAAGGCTGCTACATAA No data
Right 1059890843 9:118801839-118801861 CACTACTGGCAAAGCAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059890841 Original CRISPR TTATGTAGCAGCCTTCGTAT AGG (reversed) Intergenic
No off target data available for this crispr