ID: 1059891817

View in Genome Browser
Species Human (GRCh38)
Location 9:118812426-118812448
Sequence TAGGATACACGGCCTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059891803_1059891817 28 Left 1059891803 9:118812375-118812397 CCCCAAACCCAGTCCTCTTGGGT No data
Right 1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG No data
1059891804_1059891817 27 Left 1059891804 9:118812376-118812398 CCCAAACCCAGTCCTCTTGGGTT No data
Right 1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG No data
1059891806_1059891817 21 Left 1059891806 9:118812382-118812404 CCCAGTCCTCTTGGGTTTTTGTA No data
Right 1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG No data
1059891807_1059891817 20 Left 1059891807 9:118812383-118812405 CCAGTCCTCTTGGGTTTTTGTAG No data
Right 1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG No data
1059891808_1059891817 15 Left 1059891808 9:118812388-118812410 CCTCTTGGGTTTTTGTAGAACTC No data
Right 1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG No data
1059891805_1059891817 26 Left 1059891805 9:118812377-118812399 CCAAACCCAGTCCTCTTGGGTTT 0: 8
1: 35
2: 82
3: 157
4: 367
Right 1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059891817 Original CRISPR TAGGATACACGGCCTTCTCA GGG Intergenic
No off target data available for this crispr