ID: 1059902634

View in Genome Browser
Species Human (GRCh38)
Location 9:118945298-118945320
Sequence GCTAAGTGGGAGACAGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059902634_1059902638 2 Left 1059902634 9:118945298-118945320 CCACATGCTGTCTCCCACTTAGC No data
Right 1059902638 9:118945323-118945345 GGTTCTGCCTCTGATGTAACTGG No data
1059902634_1059902640 25 Left 1059902634 9:118945298-118945320 CCACATGCTGTCTCCCACTTAGC No data
Right 1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059902634 Original CRISPR GCTAAGTGGGAGACAGCATG TGG (reversed) Intergenic
No off target data available for this crispr