ID: 1059902637

View in Genome Browser
Species Human (GRCh38)
Location 9:118945312-118945334
Sequence AGAGGCAGAACCGAGCTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059902637_1059902640 11 Left 1059902637 9:118945312-118945334 CCACTTAGCTCGGTTCTGCCTCT No data
Right 1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059902637 Original CRISPR AGAGGCAGAACCGAGCTAAG TGG (reversed) Intergenic
No off target data available for this crispr