ID: 1059902640

View in Genome Browser
Species Human (GRCh38)
Location 9:118945346-118945368
Sequence CTGTGTGCACAGAGCCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059902637_1059902640 11 Left 1059902637 9:118945312-118945334 CCACTTAGCTCGGTTCTGCCTCT No data
Right 1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG No data
1059902639_1059902640 -7 Left 1059902639 9:118945330-118945352 CCTCTGATGTAACTGGCTGTGTG No data
Right 1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG No data
1059902636_1059902640 12 Left 1059902636 9:118945311-118945333 CCCACTTAGCTCGGTTCTGCCTC No data
Right 1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG No data
1059902634_1059902640 25 Left 1059902634 9:118945298-118945320 CCACATGCTGTCTCCCACTTAGC No data
Right 1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059902640 Original CRISPR CTGTGTGCACAGAGCCAGCA CGG Intergenic
No off target data available for this crispr