ID: 1059906196

View in Genome Browser
Species Human (GRCh38)
Location 9:118989677-118989699
Sequence AAGGGCTGGGGAAGGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059906189_1059906196 2 Left 1059906189 9:118989652-118989674 CCAGATTCAAGCAAGTAGAAGGA No data
Right 1059906196 9:118989677-118989699 AAGGGCTGGGGAAGGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059906196 Original CRISPR AAGGGCTGGGGAAGGTCTGA TGG Intergenic
No off target data available for this crispr