ID: 1059907603

View in Genome Browser
Species Human (GRCh38)
Location 9:119005550-119005572
Sequence CTTTGGAGACACATTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059907600_1059907603 -3 Left 1059907600 9:119005530-119005552 CCAAATTAATTAAGCTTGAGCTT No data
Right 1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG No data
1059907596_1059907603 17 Left 1059907596 9:119005510-119005532 CCCTATTCATCCTTCCTGATCCA No data
Right 1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG No data
1059907597_1059907603 16 Left 1059907597 9:119005511-119005533 CCTATTCATCCTTCCTGATCCAA No data
Right 1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG No data
1059907599_1059907603 3 Left 1059907599 9:119005524-119005546 CCTGATCCAAATTAATTAAGCTT No data
Right 1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG No data
1059907598_1059907603 7 Left 1059907598 9:119005520-119005542 CCTTCCTGATCCAAATTAATTAA No data
Right 1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059907603 Original CRISPR CTTTGGAGACACATTGAGCT GGG Intergenic
No off target data available for this crispr