ID: 1059913628

View in Genome Browser
Species Human (GRCh38)
Location 9:119074702-119074724
Sequence AGGAGCATAAAATTTCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059913627_1059913628 -9 Left 1059913627 9:119074688-119074710 CCGCTTAAACACTCAGGAGCATA No data
Right 1059913628 9:119074702-119074724 AGGAGCATAAAATTTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059913628 Original CRISPR AGGAGCATAAAATTTCCCAT TGG Intergenic
No off target data available for this crispr