ID: 1059914908

View in Genome Browser
Species Human (GRCh38)
Location 9:119088145-119088167
Sequence GGGTCTCCAAAGCACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059914908_1059914916 14 Left 1059914908 9:119088145-119088167 CCCACAGGGTGCTTTGGAGACCC No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data
1059914908_1059914917 20 Left 1059914908 9:119088145-119088167 CCCACAGGGTGCTTTGGAGACCC No data
Right 1059914917 9:119088188-119088210 AAGGTAAATAGGCGTGGAGCAGG No data
1059914908_1059914914 1 Left 1059914908 9:119088145-119088167 CCCACAGGGTGCTTTGGAGACCC No data
Right 1059914914 9:119088169-119088191 CCAGGCTGCAGAGAAGAGCAAGG No data
1059914908_1059914915 9 Left 1059914908 9:119088145-119088167 CCCACAGGGTGCTTTGGAGACCC No data
Right 1059914915 9:119088177-119088199 CAGAGAAGAGCAAGGTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059914908 Original CRISPR GGGTCTCCAAAGCACCCTGT GGG (reversed) Intergenic
No off target data available for this crispr