ID: 1059914911

View in Genome Browser
Species Human (GRCh38)
Location 9:119088165-119088187
Sequence GCTCTTCTCTGCAGCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059914911_1059914916 -6 Left 1059914911 9:119088165-119088187 CCCTCCAGGCTGCAGAGAAGAGC No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data
1059914911_1059914917 0 Left 1059914911 9:119088165-119088187 CCCTCCAGGCTGCAGAGAAGAGC No data
Right 1059914917 9:119088188-119088210 AAGGTAAATAGGCGTGGAGCAGG No data
1059914911_1059914918 27 Left 1059914911 9:119088165-119088187 CCCTCCAGGCTGCAGAGAAGAGC No data
Right 1059914918 9:119088215-119088237 ATCAATATTACGCAGTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059914911 Original CRISPR GCTCTTCTCTGCAGCCTGGA GGG (reversed) Intergenic
No off target data available for this crispr