ID: 1059914912

View in Genome Browser
Species Human (GRCh38)
Location 9:119088166-119088188
Sequence TGCTCTTCTCTGCAGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059914912_1059914917 -1 Left 1059914912 9:119088166-119088188 CCTCCAGGCTGCAGAGAAGAGCA No data
Right 1059914917 9:119088188-119088210 AAGGTAAATAGGCGTGGAGCAGG No data
1059914912_1059914918 26 Left 1059914912 9:119088166-119088188 CCTCCAGGCTGCAGAGAAGAGCA No data
Right 1059914918 9:119088215-119088237 ATCAATATTACGCAGTAACTAGG No data
1059914912_1059914916 -7 Left 1059914912 9:119088166-119088188 CCTCCAGGCTGCAGAGAAGAGCA No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059914912 Original CRISPR TGCTCTTCTCTGCAGCCTGG AGG (reversed) Intergenic