ID: 1059914913

View in Genome Browser
Species Human (GRCh38)
Location 9:119088169-119088191
Sequence CCTTGCTCTTCTCTGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059914913_1059914918 23 Left 1059914913 9:119088169-119088191 CCAGGCTGCAGAGAAGAGCAAGG No data
Right 1059914918 9:119088215-119088237 ATCAATATTACGCAGTAACTAGG No data
1059914913_1059914917 -4 Left 1059914913 9:119088169-119088191 CCAGGCTGCAGAGAAGAGCAAGG No data
Right 1059914917 9:119088188-119088210 AAGGTAAATAGGCGTGGAGCAGG No data
1059914913_1059914916 -10 Left 1059914913 9:119088169-119088191 CCAGGCTGCAGAGAAGAGCAAGG No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059914913 Original CRISPR CCTTGCTCTTCTCTGCAGCC TGG (reversed) Intergenic