ID: 1059914915

View in Genome Browser
Species Human (GRCh38)
Location 9:119088177-119088199
Sequence CAGAGAAGAGCAAGGTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059914908_1059914915 9 Left 1059914908 9:119088145-119088167 CCCACAGGGTGCTTTGGAGACCC No data
Right 1059914915 9:119088177-119088199 CAGAGAAGAGCAAGGTAAATAGG No data
1059914909_1059914915 8 Left 1059914909 9:119088146-119088168 CCACAGGGTGCTTTGGAGACCCT No data
Right 1059914915 9:119088177-119088199 CAGAGAAGAGCAAGGTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059914915 Original CRISPR CAGAGAAGAGCAAGGTAAAT AGG Intergenic
No off target data available for this crispr