ID: 1059914916

View in Genome Browser
Species Human (GRCh38)
Location 9:119088182-119088204
Sequence AAGAGCAAGGTAAATAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059914912_1059914916 -7 Left 1059914912 9:119088166-119088188 CCTCCAGGCTGCAGAGAAGAGCA No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data
1059914909_1059914916 13 Left 1059914909 9:119088146-119088168 CCACAGGGTGCTTTGGAGACCCT No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data
1059914911_1059914916 -6 Left 1059914911 9:119088165-119088187 CCCTCCAGGCTGCAGAGAAGAGC No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data
1059914913_1059914916 -10 Left 1059914913 9:119088169-119088191 CCAGGCTGCAGAGAAGAGCAAGG No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data
1059914908_1059914916 14 Left 1059914908 9:119088145-119088167 CCCACAGGGTGCTTTGGAGACCC No data
Right 1059914916 9:119088182-119088204 AAGAGCAAGGTAAATAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059914916 Original CRISPR AAGAGCAAGGTAAATAGGCG TGG Intergenic
No off target data available for this crispr