ID: 1059914918

View in Genome Browser
Species Human (GRCh38)
Location 9:119088215-119088237
Sequence ATCAATATTACGCAGTAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059914911_1059914918 27 Left 1059914911 9:119088165-119088187 CCCTCCAGGCTGCAGAGAAGAGC No data
Right 1059914918 9:119088215-119088237 ATCAATATTACGCAGTAACTAGG No data
1059914912_1059914918 26 Left 1059914912 9:119088166-119088188 CCTCCAGGCTGCAGAGAAGAGCA No data
Right 1059914918 9:119088215-119088237 ATCAATATTACGCAGTAACTAGG No data
1059914913_1059914918 23 Left 1059914913 9:119088169-119088191 CCAGGCTGCAGAGAAGAGCAAGG No data
Right 1059914918 9:119088215-119088237 ATCAATATTACGCAGTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059914918 Original CRISPR ATCAATATTACGCAGTAACT AGG Intergenic
No off target data available for this crispr