ID: 1059915223

View in Genome Browser
Species Human (GRCh38)
Location 9:119092229-119092251
Sequence TTGACCTTTCCAATAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059915223_1059915225 -4 Left 1059915223 9:119092229-119092251 CCCAGGGTTATTGGAAAGGTCAA No data
Right 1059915225 9:119092248-119092270 TCAAATGTTAAAATAAATATTGG No data
1059915223_1059915226 5 Left 1059915223 9:119092229-119092251 CCCAGGGTTATTGGAAAGGTCAA No data
Right 1059915226 9:119092257-119092279 AAAATAAATATTGGAGTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059915223 Original CRISPR TTGACCTTTCCAATAACCCT GGG (reversed) Intergenic
No off target data available for this crispr