ID: 1059915320

View in Genome Browser
Species Human (GRCh38)
Location 9:119093289-119093311
Sequence CTGTGGGGATGGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059915312_1059915320 23 Left 1059915312 9:119093243-119093265 CCTCTGGCTATTAATCAGCACCT No data
Right 1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG No data
1059915313_1059915320 3 Left 1059915313 9:119093263-119093285 CCTTTACTGATGAATCTGCAGCA No data
Right 1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059915320 Original CRISPR CTGTGGGGATGGAAGGATGG AGG Intergenic
No off target data available for this crispr