ID: 1059915618

View in Genome Browser
Species Human (GRCh38)
Location 9:119096442-119096464
Sequence TTGTAGGTGAATAAACTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059915618_1059915620 7 Left 1059915618 9:119096442-119096464 CCTTTCAGTTTATTCACCTACAA No data
Right 1059915620 9:119096472-119096494 ATAGTAACAAGTACCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059915618 Original CRISPR TTGTAGGTGAATAAACTGAA AGG (reversed) Intergenic
No off target data available for this crispr