ID: 1059917171

View in Genome Browser
Species Human (GRCh38)
Location 9:119116958-119116980
Sequence CAAAATGTTGATAGAAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059917168_1059917171 -4 Left 1059917168 9:119116939-119116961 CCGGTAAAATGGTTGCAACCAAA No data
Right 1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059917171 Original CRISPR CAAAATGTTGATAGAAATAT GGG Intergenic
No off target data available for this crispr