ID: 1059923817

View in Genome Browser
Species Human (GRCh38)
Location 9:119186500-119186522
Sequence CTGCTCTGCCAGCTTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059923817_1059923823 21 Left 1059923817 9:119186500-119186522 CCATGCCCAAGCTGGCAGAGCAG 0: 1
1: 0
2: 3
3: 41
4: 336
Right 1059923823 9:119186544-119186566 ACCAACTAGTCTCAGGTAATTGG No data
1059923817_1059923825 29 Left 1059923817 9:119186500-119186522 CCATGCCCAAGCTGGCAGAGCAG 0: 1
1: 0
2: 3
3: 41
4: 336
Right 1059923825 9:119186552-119186574 GTCTCAGGTAATTGGAGCTTTGG No data
1059923817_1059923821 14 Left 1059923817 9:119186500-119186522 CCATGCCCAAGCTGGCAGAGCAG 0: 1
1: 0
2: 3
3: 41
4: 336
Right 1059923821 9:119186537-119186559 CACCTGAACCAACTAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059923817 Original CRISPR CTGCTCTGCCAGCTTGGGCA TGG (reversed) Intronic
900624450 1:3601817-3601839 CTGCGCTGCTCCCTTGGGCATGG - Intronic
900635725 1:3664132-3664154 CTGCCCTGCCAGTCTGGGCACGG + Intronic
901201954 1:7472142-7472164 CTGTGCTGCCAGCGTGGGCCAGG - Intronic
902728583 1:18353326-18353348 CAGCCCTTCCAACTTGGGCAGGG + Intronic
903185261 1:21625188-21625210 CTGCCCTCCCAGCCTAGGCAAGG + Intronic
903342039 1:22660736-22660758 CTGCGCTGGAACCTTGGGCAGGG - Intronic
904042526 1:27592895-27592917 CTGCTGTGTGAGCTTGGGCCAGG - Intronic
904078716 1:27858655-27858677 CAGCTGTGCCAGGTTGGGCCTGG + Intergenic
904132859 1:28288252-28288274 CTGTACTGCCAGCATGAGCAGGG - Intergenic
904807187 1:33140427-33140449 CAGATCTGGCAGCTTGGTCAGGG + Intergenic
904910870 1:33933227-33933249 CTGCTCTGCCAACTTAGGTTGGG - Intronic
905012709 1:34758166-34758188 CTGGTCTGGCAGGTTGGGCCTGG + Exonic
906102602 1:43272766-43272788 CTGCTCTGCCAGCATGTCCGGGG - Exonic
906639819 1:47434998-47435020 CTGCTCTGCAGGGTTGGGGAGGG - Intergenic
907410584 1:54280746-54280768 CTGTTTTGCCAGGTTGGGCGCGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907518400 1:55007692-55007714 CTGCTCTGTGACCTTGGGCAAGG + Intronic
910150270 1:84134191-84134213 CTTCTCTGCCAGCTGGGTCAGGG + Intronic
912274498 1:108242097-108242119 CTTCTCTGCCAGCTTCTCCATGG + Exonic
912286769 1:108377761-108377783 CTTCTCTGCCAGCTTCTCCATGG - Intronic
912293721 1:108452244-108452266 CTTCTCTGCCAGCTTCTCCATGG - Exonic
912682864 1:111739897-111739919 CTGCTCCGCCCGCGAGGGCAGGG - Intronic
913211809 1:116588731-116588753 CTCCTCTGCCAGCTTGTACCAGG + Exonic
914575946 1:148968851-148968873 CTGCTCTGCAAACTTGGACCAGG + Exonic
914900063 1:151707011-151707033 CTGCCCTGCCATCCTGGGCGGGG - Intronic
915240936 1:154521231-154521253 CTGGCCTTCCAGCTTGGGCTTGG + Intronic
915304676 1:154970562-154970584 CCCCCCTGCCAGTTTGGGCAAGG + Exonic
915455241 1:156036155-156036177 CTCTTCTGCCAGCTCGGGCCTGG + Exonic
915716076 1:157946470-157946492 CTGCAGTGCCAGCCTAGGCATGG - Intergenic
917660611 1:177173573-177173595 CTGCTCTGTCAGCATGGGGCTGG + Intronic
917845098 1:179014167-179014189 CTGCTCTTCCTGCTTGAGCTTGG - Intergenic
918162631 1:181915452-181915474 CTGCTCTGCTAGATTGGGGCTGG + Intergenic
919835135 1:201568183-201568205 CTGCTCCTCCAGCTTGGTGATGG + Intergenic
920226581 1:204443447-204443469 CTGCTGGGCCAGTTTGGCCAGGG + Exonic
920508008 1:206530710-206530732 CTTCTCTGCCAAGTGGGGCAGGG + Intronic
920830215 1:209457838-209457860 TAGCTCTGCCACCTTGGGGAAGG + Intergenic
921530434 1:216276171-216276193 CTGCTTTACCAGCTTTGGTAAGG + Intronic
921949978 1:220919403-220919425 AAGCTCTGCCTGCTTGGGCAAGG - Intergenic
922320438 1:224481981-224482003 CTCCTCTGCCTGCTGGGGAAAGG - Intronic
924284371 1:242470701-242470723 TGGCTCTGCCAGCTTCGGTATGG + Intronic
1063272723 10:4529660-4529682 CTGCTCTGTCTGCCTGGCCATGG - Intergenic
1064213031 10:13376778-13376800 TCGCACTGCCAGCTTGGGAAGGG - Intergenic
1065916356 10:30357469-30357491 CATGCCTGCCAGCTTGGGCATGG - Intronic
1066156015 10:32678752-32678774 GTGCTGTGACAGCTTGGGGAAGG + Intronic
1067219820 10:44336007-44336029 CTGCTCTCCCATCTTTGGAAAGG + Intergenic
1069616369 10:69808942-69808964 CTGCTCTCCCAGCCAGGACAAGG - Intronic
1069633409 10:69911239-69911261 CTGATCTGCCAGCCAGAGCAAGG + Intronic
1070673944 10:78399046-78399068 CTGCTTTGCCAACTTGGGTGTGG + Intergenic
1070757909 10:79004972-79004994 CTGGGCTTCCAGCCTGGGCAGGG + Intergenic
1072618042 10:97062746-97062768 AGGCTCTGCAAGCTTGGCCAGGG - Intronic
1074865442 10:117542194-117542216 CTGTCCTACCAGCTTGGGCGAGG + Intergenic
1075349896 10:121714461-121714483 TTGCTCTGCCATCCTTGGCATGG - Intergenic
1075635555 10:124027878-124027900 CTGCCCTCCGAGCTTAGGCAAGG + Intronic
1076143901 10:128101447-128101469 CTCCTCTGCCACCTTAGGCTGGG + Exonic
1076890902 10:133282874-133282896 CTGCCCTGGCAGCGTGGGCAGGG - Intronic
1077273779 11:1693948-1693970 GGGCTCTGCCCGCTTGGGCCAGG + Intergenic
1077353355 11:2103238-2103260 CTCCTCTGCCAGACTGGCCATGG - Intergenic
1077589340 11:3479589-3479611 CCCCTCTGCCAGGTTGAGCAGGG + Intergenic
1079444530 11:20546866-20546888 CAGAGCTGACAGCTTGGGCAAGG + Intergenic
1080643936 11:34174618-34174640 GTCCTCTGCCAGCTCTGGCAAGG + Intronic
1081753876 11:45531140-45531162 CTCCTATGCTAGCATGGGCATGG - Intergenic
1082092461 11:48101162-48101184 CCGCTCTGCAAGCTTGGTGAGGG - Intronic
1083153644 11:60809479-60809501 CTGCTGTGCCACCTTAGGCAAGG - Intergenic
1083429890 11:62608861-62608883 CTGCTCTGCAAGCTTGGAGAAGG - Intronic
1083697084 11:64450010-64450032 CTGCTCTGCCACCTCGTGCCAGG - Exonic
1083756888 11:64796709-64796731 CTGGTCTGCCAGTTTGGGCATGG + Exonic
1084307863 11:68298547-68298569 CTTCTTTGCCAGCTTTGGCGAGG + Intergenic
1084743873 11:71155463-71155485 CTCCTCTGGGAGCGTGGGCAGGG - Intronic
1085864328 11:80271031-80271053 GTGCCATGCCAGCTTGGGGAAGG - Intergenic
1087608445 11:100405563-100405585 CTTCCCTGCCAGCTGGGTCAGGG + Intergenic
1089858439 11:121567640-121567662 CTGCTCTTGCTGCTTGGTCATGG - Intronic
1090955836 11:131512390-131512412 TTGCTCTGCCAGCCCAGGCAGGG + Intronic
1092004848 12:5060715-5060737 CTGTTGTGCCAGCTAGTGCAAGG + Intergenic
1092078093 12:5690037-5690059 CTGCTGTGCCTGCTTGTACAGGG - Intronic
1093497993 12:19779599-19779621 CTGCTCTGCTAGCCTGAGCCGGG + Intergenic
1093747525 12:22760040-22760062 CTGCTTTGCCAGGTTGAGAACGG - Intergenic
1095185791 12:39199160-39199182 CAGCTCTACCAGCTGTGGCAGGG + Intergenic
1095190971 12:39257504-39257526 CTGCCCTGCAAGCATGGGAAGGG - Intergenic
1095956893 12:47812110-47812132 CTGCTGTGCCAGCTTGGGGAGGG - Intronic
1097188490 12:57208406-57208428 CAGCTGGGCCTGCTTGGGCAGGG + Intronic
1097277670 12:57824226-57824248 CTTCACTGCCAGCCTGGCCAAGG - Exonic
1097588673 12:61546063-61546085 TTGCTCTGTGACCTTGGGCAAGG - Intergenic
1101728252 12:107405649-107405671 CTGATCTGCCAGCTTATGCTGGG + Intronic
1102146651 12:110659544-110659566 AGGCTCTGCCACCTTGGGGATGG + Intronic
1103721126 12:122976161-122976183 CTGCTGTAAAAGCTTGGGCAAGG - Intronic
1103949455 12:124543085-124543107 CTCCTCCACCAGCTAGGGCAAGG + Intronic
1104934493 12:132357318-132357340 GGGCTCTGCCAGCCTGGGCCTGG - Intergenic
1104970737 12:132529545-132529567 CTTCTCTGCCACCCTGGGCTCGG + Intronic
1105215065 13:18279357-18279379 CTCCTCTGCCAGCTTGTACCAGG + Intergenic
1105544574 13:21342219-21342241 CTCCTCTGCCACCTGGGGCTGGG - Intergenic
1106287392 13:28329559-28329581 CTGTTCTCCCAGCCTGTGCAGGG + Intronic
1111602604 13:90494101-90494123 CTGCTGTGCCAACTTGGGGAAGG + Intergenic
1113628803 13:111866046-111866068 CTGCTCAGCTTCCTTGGGCAGGG + Intergenic
1114222557 14:20709893-20709915 CTGCTGTGTCAGGTTGGGGAGGG + Intergenic
1118098498 14:62567537-62567559 CTGCTCTTCCAGCAGGTGCATGG - Intergenic
1118352990 14:64987274-64987296 TTGCGCGGCCAGCTTGGGGAAGG + Intronic
1118767877 14:68922249-68922271 CTGCTCTGACAGGGTGGGCCTGG - Intronic
1121405462 14:93716878-93716900 GTGCTCTGCCTGCTTGTGCAGGG - Intergenic
1121687161 14:95844937-95844959 CTGCTCTGCCACCAGGGGCTAGG - Intergenic
1122571527 14:102706074-102706096 TTGCTCCTCCAGCCTGGGCAAGG + Intronic
1122609633 14:102973112-102973134 CTGCCCTGCCAGCTTGCTCAGGG - Intronic
1123671743 15:22665227-22665249 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1124323785 15:28738453-28738475 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1124490520 15:30152190-30152212 CACATCTGCCAGCTTGGGCACGG + Intergenic
1124527677 15:30471694-30471716 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1124753013 15:32386139-32386161 CACATCTGCCAGCTTGGGCACGG - Intergenic
1124770982 15:32536008-32536030 CTGCTCTGCCAGCATCTTCAGGG + Intergenic
1124974758 15:34521839-34521861 CACATCTGCCAGCTTGGGCACGG - Intergenic
1125587767 15:40833198-40833220 CTGCTCTCCTGGCTTGGGCCAGG + Intergenic
1125725706 15:41867149-41867171 CTGCTCTCCCACCCTGGGCTGGG + Intronic
1127109517 15:55652580-55652602 CTGCTCTGACACCTGGGTCATGG + Intronic
1127533303 15:59865906-59865928 TTGCTCTGTGACCTTGGGCAAGG + Intergenic
1128162752 15:65435061-65435083 CTGCACTGTGACCTTGGGCAAGG + Intergenic
1128789718 15:70424002-70424024 CTTCTCTTCCTGCCTGGGCACGG + Intergenic
1129210195 15:74063939-74063961 CACATCTGCCAACTTGGGCATGG - Intergenic
1129403827 15:75301463-75301485 CACATCTGCCAACTTGGGCATGG + Intergenic
1129476832 15:75791421-75791443 CACGTCTGCCACCTTGGGCATGG + Intergenic
1129479982 15:75816005-75816027 CAGCACTGCCAGCTTTGGGATGG - Intergenic
1129606228 15:77026337-77026359 CTGCCCTGCCACCCTGTGCAGGG - Intronic
1129716161 15:77852342-77852364 CTGTTGTGTGAGCTTGGGCAGGG - Intergenic
1129727395 15:77908549-77908571 CATGTCTGCCAGCTTGGGCATGG - Intergenic
1129840486 15:78740437-78740459 CATGTCTGCCAGCTTGGGCATGG + Intergenic
1129842005 15:78749763-78749785 CACATCTGCCAGCTTGGGCACGG + Intergenic
1130282897 15:82532949-82532971 CACATCTGCCAGCTTGGGCATGG + Intergenic
1130317787 15:82810602-82810624 CTGCTCTGCCAGCATCTTCAGGG - Intronic
1130485664 15:84396984-84397006 CACATCTGCCAGCTTGGGCATGG + Intergenic
1130490073 15:84424972-84424994 CACATCTGCCACCTTGGGCATGG - Intergenic
1130590357 15:85207319-85207341 CACATCTGCCACCTTGGGCATGG - Intergenic
1131000958 15:88939595-88939617 TTGCTCTGTCAGTTTGGGCTTGG - Intergenic
1131378230 15:91942916-91942938 CTGCTCTGCCCGAGTGGGCGTGG + Intronic
1131399752 15:92114865-92114887 CAGCTCTGCATTCTTGGGCAAGG + Intronic
1132012488 15:98288246-98288268 CTGCTCTGGAAGCCTTGGCAGGG - Intergenic
1132024259 15:98391599-98391621 CTCATCTGCCAGATGGGGCAAGG + Intergenic
1133022757 16:2974123-2974145 CTGCTCTGCTGGCTCTGGCATGG - Exonic
1133782168 16:8947968-8947990 CTGCCCTGGAAGCTTGGACATGG + Intronic
1136033387 16:27519621-27519643 CAGCTCTGTGACCTTGGGCAAGG + Intronic
1136121043 16:28134522-28134544 AAGCTCTGCAACCTTGGGCATGG - Intronic
1136139231 16:28278090-28278112 CTGCTCTGCCTGCGTGGCCTCGG - Intergenic
1136570400 16:31093411-31093433 CCCCTCTGCCAGGTGGGGCAGGG - Exonic
1136576650 16:31129284-31129306 CTGCTCTGCCTTCCTGAGCATGG + Intronic
1136600561 16:31284476-31284498 CTGCTGTGCTAGCGTGAGCAAGG + Intronic
1137406721 16:48194941-48194963 CAACTCTGCAAGTTTGGGCAAGG - Intronic
1138656170 16:58492809-58492831 CTCCTCAGCCCGCTTGTGCAAGG + Intronic
1139335139 16:66226259-66226281 CTGTTCTGCCAGCCTAGGGAGGG + Intergenic
1139526785 16:67521632-67521654 GTGCTCTGCTGGTTTGGGCAAGG - Intronic
1140214935 16:72999702-72999724 CTTCGATGCCAGCGTGGGCAGGG + Intronic
1141449662 16:84089739-84089761 CAGCTCTTCCAGCATGGACATGG - Intronic
1141560332 16:84863568-84863590 CAGCTGTGCGAGCCTGGGCAGGG + Intronic
1141575106 16:84958679-84958701 CTGCGTGGCCAGCTTGGGAAGGG + Intergenic
1142126496 16:88413222-88413244 CTGCTCTGCCTTCTTGGTCCCGG - Intergenic
1142592180 17:1011072-1011094 CTGCTGTGGCTGCTTGGGAAAGG + Intronic
1142609391 17:1100316-1100338 GTGCTCTGCCTGCCTGGGCGGGG - Intronic
1142668316 17:1475014-1475036 CTGGTCAGCCAGCTTGTGCCTGG + Exonic
1143474056 17:7192945-7192967 CTGCTCTGCCACCTCTCGCACGG + Exonic
1143580724 17:7824191-7824213 GTGCTCTGCCAGCTGCAGCAGGG - Exonic
1144670734 17:17131291-17131313 CTGCTCTCCCAGAGTGGGCTTGG - Intronic
1145397694 17:22508030-22508052 CTGCTCTGCCACCTTGTGGAGGG + Intergenic
1145829787 17:27906766-27906788 AGGCTCTGCCTGCTGGGGCAGGG - Intergenic
1146908647 17:36633728-36633750 CTGCTCTGCCAGCCTGCTCCAGG - Intergenic
1147160035 17:38564263-38564285 CTGGTCTGCCAGCCCGGGCTGGG + Exonic
1147359578 17:39922512-39922534 CTCCCCTGCCACCCTGGGCAGGG + Exonic
1148158984 17:45439398-45439420 CTGCCCTGCGTGCTTGGGCCAGG + Intronic
1148844274 17:50519631-50519653 CTGTTCTCCCAGCTCTGGCAAGG - Exonic
1149541384 17:57470622-57470644 CTACTCTGCCAGCTAGGTCTGGG - Intronic
1150390340 17:64786488-64786510 CTGCCCTGCGTGCTTGGGCCAGG + Intergenic
1151383542 17:73741604-73741626 CTTCTCCTCCTGCTTGGGCAAGG - Intergenic
1151671475 17:75573792-75573814 CTGGACTGCCAGCTTGCACAGGG - Intronic
1152068007 17:78121984-78122006 CAGCCCTGCCCGCTGGGGCAGGG + Intronic
1153614933 18:6925610-6925632 CTGCTCTGTCACAGTGGGCATGG - Intergenic
1154163133 18:11994790-11994812 CTGCTCAACCAGCCTGGGTAAGG - Intronic
1155855881 18:30833869-30833891 CTGCTCTGACAGCAGGGGCCAGG + Intergenic
1156472631 18:37387305-37387327 CTGCTCTGCTGGTTTGGGGAGGG - Intronic
1157043617 18:44068599-44068621 CTGCGTTGCCAGCTTGGAGAGGG - Intergenic
1157400954 18:47386837-47386859 CTGCAATGCCATCTTGGGCTGGG - Intergenic
1157563487 18:48664354-48664376 CTGCTCTGCCAGGTTCAGCCTGG + Intronic
1157613554 18:48974362-48974384 CTGCTCTGCCAGGGTGGGTAGGG - Intergenic
1157622734 18:49025683-49025705 CTGCTCTGCCAGCTCTGTCCTGG + Intergenic
1158440558 18:57471032-57471054 CTTCTCTCTCAGCTTGGGGAGGG - Intronic
1160340614 18:78085779-78085801 CTGCTGTGCCAGGCTGGGGAAGG - Intergenic
1160498360 18:79388263-79388285 CTGCCCTGTCAGCGGGGGCAAGG - Intergenic
1161365912 19:3879713-3879735 CTGGTCTGCCAGCTGGGGAGTGG + Intergenic
1163426812 19:17244857-17244879 CTGCTCGGTCACCTTGGGCCTGG - Intronic
1163517655 19:17774740-17774762 ATCCTGGGCCAGCTTGGGCAGGG - Intronic
1163658900 19:18564801-18564823 CTTCTGGGCCAGGTTGGGCAGGG + Intronic
1164463206 19:28465652-28465674 CAGCTCTGCCAGCAGGGCCAGGG - Intergenic
1164578993 19:29422809-29422831 CTGCCCTGCCAGCCTTGGTAAGG + Intergenic
1165160845 19:33814880-33814902 CTGCTCTGCGGCCTTGGACAGGG - Intronic
1166313213 19:41974988-41975010 CCCCTCTGCCAGCCTGGGCTGGG - Intronic
1166343443 19:42151587-42151609 CAGACCTTCCAGCTTGGGCAAGG + Intronic
1166730749 19:45057740-45057762 CTTCTCTGCCAGCCTGAGAAAGG - Exonic
1168540435 19:57205420-57205442 CTGATCTGCCACCTAGAGCATGG + Exonic
925118246 2:1398342-1398364 CTTCTATGCCAGCTCTGGCACGG + Intronic
925521799 2:4754691-4754713 CTTTTCTTCCAGTTTGGGCAGGG + Intergenic
925908827 2:8558002-8558024 TAGCTGTGCCAGCTTGGGGAAGG - Intergenic
926197531 2:10772842-10772864 CTGCTCGGCCAGGTGGGGCCAGG - Intronic
927118591 2:19929465-19929487 CTGGTCTTTCAGCTTGGCCATGG - Intronic
927159437 2:20243302-20243324 CTGCTCTGCCAGCCTGTGCTGGG + Intergenic
928209309 2:29311935-29311957 CTCCCCAGCCAGCATGGGCATGG - Intronic
928784344 2:34864225-34864247 CTGCTCTGCCAGGTGGAGCCAGG - Intergenic
929436292 2:41931073-41931095 ATCTTCTGCCAGCTGGGGCAGGG - Intergenic
932453343 2:71830162-71830184 CTTCTCTCCAACCTTGGGCATGG - Intergenic
932732060 2:74228256-74228278 CTGCTCAGCCTGCAGGGGCATGG + Intronic
934299255 2:91767380-91767402 CTCCTCTGCCAGCTTGTACCAGG - Intergenic
934950984 2:98575260-98575282 CTGCAGTGCCCTCTTGGGCAAGG + Intronic
936276438 2:111101806-111101828 CTACTCTGCCAGGGTGGGAAGGG + Intronic
936493314 2:112994796-112994818 TTGCTCTGCCATCTTGCTCAAGG - Intergenic
937155325 2:119714873-119714895 CTGCAATGCAAGCTTGGGCAAGG + Intergenic
937308739 2:120888194-120888216 CTGTTTTGCCCGCTGGGGCAAGG + Intronic
941110310 2:161414366-161414388 CTGCGCTGGCGGCCTGGGCAGGG - Intergenic
942157760 2:173148919-173148941 CTGCTCTCCCAGATTGAGCCAGG + Intronic
942526742 2:176861175-176861197 CTGTTCTGCAACCTTGGGGATGG + Intergenic
942686962 2:178542884-178542906 CTGGTCTGCCAGCTGGGACATGG + Exonic
946026232 2:216673425-216673447 CTGCTTTGCCAGGTGGGTCAGGG + Exonic
946093180 2:217248633-217248655 CTGCTATGCCAGCATTTGCAGGG + Intergenic
947594642 2:231403325-231403347 CTCTTCTGCCAGGTTGAGCAGGG - Intergenic
948172849 2:235919283-235919305 CTCCTCTGCCAGTGTGGGAAAGG - Intronic
948248742 2:236507813-236507835 CAGCTCTGCGGCCTTGGGCAAGG + Intergenic
948270947 2:236672721-236672743 CTGCTCTGCCAGGCCAGGCAGGG + Intergenic
948505577 2:238425220-238425242 CTGCTCTGCCTGCCTGGTCCCGG - Intergenic
948694075 2:239724433-239724455 CTGCTCTGCCATGCTGGGCTGGG + Intergenic
1168858851 20:1030279-1030301 GGGCTCTGCCAGCCTGGGAAAGG - Intergenic
1169227862 20:3867203-3867225 CAGCTCTGTGACCTTGGGCAAGG + Exonic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1169786048 20:9360130-9360152 CTGCTCTGTGACCTTAGGCAAGG + Intronic
1170281730 20:14656544-14656566 ATGCACTGCCAGTTTTGGCAAGG - Intronic
1172631016 20:36378157-36378179 CTCCTCTGCCAGGTTGAGTAGGG - Intronic
1172798630 20:37560777-37560799 CACCTCTGACAGCTGGGGCAGGG - Intergenic
1172966296 20:38838021-38838043 CCGCTCTGCCACCTTGGTCAAGG - Intronic
1173667104 20:44771024-44771046 CTGCTGTGTGACCTTGGGCAAGG - Intronic
1174340977 20:49894995-49895017 CTGCTCTGCCATCCTCAGCATGG - Intergenic
1174709848 20:52692856-52692878 CTGATCGGCCAACTTGGGCCTGG - Intergenic
1174733925 20:52945942-52945964 TTGCTCTCTCTGCTTGGGCAGGG - Intergenic
1177067150 21:16453934-16453956 ATGCTCTACCATCTAGGGCAAGG + Intergenic
1177262452 21:18748639-18748661 CTGCTCTGCCAGCTTAGAAGGGG + Intergenic
1178200108 21:30393923-30393945 ATGCTCAGACATCTTGGGCAGGG + Intronic
1178417080 21:32412710-32412732 AGGCTCTGGCAGCCTGGGCAGGG + Exonic
1179081102 21:38171461-38171483 TTGCTCTGTGACCTTGGGCATGG - Intronic
1179457908 21:41512256-41512278 ATGCTCTGCAGGCTGGGGCAAGG - Intronic
1179591949 21:42414850-42414872 CTGCTCCGCCAGCCTGGTTAGGG - Intronic
1180763002 22:18223276-18223298 CTGCTCAGCCAGGGTGGGAAGGG + Intergenic
1180772641 22:18401271-18401293 CTGCTCAGCCAGGGTGGGAAGGG - Intergenic
1180804021 22:18650887-18650909 CTGCTCAGCCAGGGTGGGAAGGG - Intergenic
1180806742 22:18718562-18718584 CTGCTCAGCCAGGGTGGGAAGGG + Intergenic
1181217698 22:21344372-21344394 CTGCTCAGCCAGGGTGGGAAGGG + Intergenic
1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG + Exonic
1181474234 22:23158753-23158775 CTGCTCAGCCAGTGTGGGCCAGG + Intronic
1183352697 22:37342938-37342960 CTGCTGTGTGACCTTGGGCAAGG - Intergenic
1183962143 22:41417995-41418017 CTGTCCTGCCACCTTGGGCAAGG - Intergenic
1184767313 22:46578387-46578409 CTGCTCTGTGACCTTGGGCAAGG + Intronic
1203234479 22_KI270731v1_random:142259-142281 CTGCTCAGCCAGGGTGGGAAGGG - Intergenic
951530663 3:23695229-23695251 CTTCTCTGCCAGCTTGGAGTTGG + Intergenic
952879021 3:37971478-37971500 CTTTACTGCCAGCTTGGCCAAGG + Exonic
953171630 3:40512425-40512447 CTGGTCTCCCAGCTGGAGCAAGG + Exonic
953475655 3:43203717-43203739 TTTCTCTTACAGCTTGGGCAGGG - Intergenic
953891281 3:46753460-46753482 CTGCTCTGCCAGGTGGGCCACGG - Intronic
954701158 3:52451582-52451604 CTGCTCTGCCTCCTGGGGCATGG - Intronic
955395873 3:58556870-58556892 CTACTCTGCCAGATTGGTAAAGG + Intergenic
955960889 3:64340281-64340303 CTTCTCTGCCCCCTTGGGGAAGG - Intronic
955977152 3:64490091-64490113 ATGCTATGCTACCTTGGGCATGG + Intergenic
957083095 3:75655552-75655574 CTGCTGGGCCAGCTCGGGCTGGG + Intergenic
957614424 3:82509148-82509170 CTGCCCTGCCAACTTGGAAAGGG - Intergenic
960936517 3:122907484-122907506 CTGCTGAGCCAGCTGGGACAAGG + Intergenic
961479160 3:127168442-127168464 CAGCTCTGGCAGCCTGGACACGG - Intergenic
961552989 3:127679734-127679756 CTGCCCTGCCAGCCTGCTCAGGG + Intronic
962205058 3:133427573-133427595 CTCCTCAGCCAGCTTGGGGTTGG + Intronic
963732147 3:148985038-148985060 CTCTTCTGCCAGCTTGGGCCTGG + Intergenic
963904631 3:150763267-150763289 CTGCGCTGCCAGCTGGAGCCGGG - Exonic
965587663 3:170333451-170333473 CTGCCCTGCCAGATTGTACATGG + Intergenic
965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG + Intronic
965886409 3:173451809-173451831 CTGCTATGCTAGCATGAGCAAGG + Intronic
967120566 3:186379017-186379039 CTGGTTTGCCAGCTTGTGGATGG - Intergenic
967522302 3:190446968-190446990 CTGCTCTTTCAGCTTTTGCATGG - Intronic
967700555 3:192587523-192587545 ATACTCTCCCAGGTTGGGCATGG + Intronic
968295997 3:197577017-197577039 CTACTCCTCCAGCTTGGGGAGGG + Intergenic
969087507 4:4667484-4667506 CTCTTCTGCCAGCTTGGCCAAGG - Intergenic
969671319 4:8591895-8591917 GTGCACTGCCAGCTGGGGCTCGG + Intronic
969672590 4:8598001-8598023 GTTCCCTGCCAGCTTGGACAGGG + Intronic
969938229 4:10704581-10704603 CTGCTCCTCTAGGTTGGGCAGGG + Intergenic
970702094 4:18754184-18754206 TAGATGTGCCAGCTTGGGCAAGG - Intergenic
971634130 4:29034489-29034511 CTGCTCTGTCACTTTGGGCAAGG + Intergenic
971876946 4:32319351-32319373 CTGCTGCGCCAGGGTGGGCATGG + Intergenic
975747140 4:77485804-77485826 GTGCACTGCCAGATTGGCCAAGG - Intergenic
977203233 4:94140848-94140870 CTCCTCTGCCACCTTTGTCAGGG + Intergenic
977555458 4:98483613-98483635 CTGCTCTGTGAGGGTGGGCACGG + Intronic
982466527 4:155739847-155739869 CTGCTATGGCTGCTTGGTCAAGG + Intergenic
985587208 5:746624-746646 CTGCTCTGCCACCTGAGGCAAGG + Intronic
985601772 5:838792-838814 CTGCTCTGCCGCCTGAGGCAAGG + Intronic
985683992 5:1272153-1272175 CTGCCCTGCAGGGTTGGGCACGG - Intronic
986286290 5:6361340-6361362 CTGCTCTGCCATCCTCAGCATGG - Intergenic
993173422 5:84451447-84451469 GTGCTGTGCCAGCTTGGGGAGGG - Intergenic
995851256 5:116548273-116548295 CTGTTCAGCCACCTTGGGCATGG - Intronic
998179447 5:139926219-139926241 CTGCTCTGCCAGGGTCAGCATGG + Intronic
998382323 5:141734756-141734778 CTGTTCTGCCAGCCTTGTCAAGG - Intergenic
999233342 5:150075852-150075874 CTGCACTGGGAGCTTTGGCAGGG - Intronic
999395115 5:151222377-151222399 CTCCTCTTCCAGCTTGTGGAAGG + Intronic
1001235955 5:170029850-170029872 GGGCTCTGCCTGCTTGGGCAGGG - Intronic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1002471485 5:179438507-179438529 CTTCACTGCCAGCCTGGCCATGG + Intergenic
1003336757 6:5180681-5180703 CTGCTCTGCCAGCGTGGACCTGG + Intronic
1003407051 6:5834334-5834356 CTCCTCTGCCACCTGGGGCCGGG + Intergenic
1004322155 6:14640417-14640439 CTGCGCTCCCAGCTTGGTCTGGG - Intergenic
1005583633 6:27255269-27255291 CTCCTTTGCCAGCTTGAGCCAGG - Exonic
1006394681 6:33779489-33779511 CTGCTCTGCCAGCAGGGGACAGG + Intronic
1007494897 6:42252983-42253005 CTGGTCTGCCTGCTGGGGAAGGG + Intronic
1007572074 6:42900079-42900101 CTGCGCTGCCTGCTGTGGCAGGG + Intergenic
1007750828 6:44070263-44070285 GCCCTCTGCCAGCATGGGCATGG - Intergenic
1008125155 6:47659819-47659841 CTTCTGTGCAAGCTTGGGCACGG + Intronic
1014252232 6:119127013-119127035 TTTCTCTGCCAGCTGGGTCAGGG + Intronic
1015882046 6:137879471-137879493 CTTTTCTACCAGCTTGTGCAGGG + Intronic
1017780835 6:157714022-157714044 CTGCTCTGCCAGGAGGGGCAGGG + Intronic
1017858759 6:158375970-158375992 CTGCTTTGCTAGCTAGGGCTGGG + Intronic
1018681876 6:166271511-166271533 CTGCTCTGCCTGCTGGCACAGGG - Intergenic
1018739617 6:166717446-166717468 CTGCTCTGCCACCCTGAGAATGG + Intronic
1019210583 6:170401456-170401478 CTTCTCTGCCAGCTTCTGGACGG - Intronic
1019577705 7:1745510-1745532 CTGCGTGGCCAGCGTGGGCAGGG - Exonic
1019868662 7:3737430-3737452 CTGCTCTGCTAGGTGGGGCTTGG + Intronic
1020089422 7:5330338-5330360 CTACTCTGGAAGCTGGGGCAGGG - Intronic
1020195222 7:6032896-6032918 CTGCTCTGCCTGTTACGGCACGG + Exonic
1020761116 7:12269328-12269350 CTGCCCTGCCAGCTTGGAAGGGG - Intergenic
1021157709 7:17232113-17232135 CTGCTCTAACAGCTTTGGCCAGG + Intergenic
1021286576 7:18788150-18788172 CTTCTCTGCCAGCTGGAGCTTGG + Intronic
1021691011 7:23230725-23230747 CTCCTCTGCCACCTTGGCCCAGG + Intergenic
1022140808 7:27491766-27491788 CTGCTTTGCCCGCTTGAGCTTGG + Intergenic
1022417285 7:30189164-30189186 CAGCTCTGCCACCCTGGGCCTGG + Intergenic
1024346760 7:48321718-48321740 CTCCTCTGCCAGCCTGGCCTAGG - Intronic
1024430044 7:49277738-49277760 CAGTTCTGCCAGCCTGGGAATGG + Intergenic
1027237021 7:76304058-76304080 CTGCGTGGCTAGCTTGGGCATGG - Exonic
1027463595 7:78486519-78486541 CTCATCTGCCATCTTGGGCCAGG - Intronic
1028509739 7:91610677-91610699 CTTATTTCCCAGCTTGGGCAGGG - Intergenic
1029448404 7:100627375-100627397 CTGCCCTGCGAGCTGGGCCACGG + Exonic
1029478808 7:100800971-100800993 ATGCTCTTCCAGCTAGGGCAAGG - Intergenic
1033257427 7:139814354-139814376 AAGCTCTGCCATCTTGGGGAGGG - Intronic
1038041568 8:23727855-23727877 CTGCTCTCCCAGCCTGGGAAGGG + Intergenic
1038335659 8:26643461-26643483 CATCACTGCCAGCTTGGGAACGG + Exonic
1043671800 8:82895747-82895769 CTACTCTCCCAGCTTAGGCCTGG + Intergenic
1044412674 8:91901882-91901904 CTGCTCTGCCAACTTGGAAGGGG + Intergenic
1048870035 8:138789766-138789788 CAGCTCTGTCACCTTGGCCATGG + Intronic
1049431376 8:142566859-142566881 CTGCCCTGGCAGCCTGGCCAAGG + Intergenic
1050923584 9:11235455-11235477 CTGCTCTGTCAGATGGGGCTAGG + Intergenic
1051122035 9:13761874-13761896 CTGATGTGCCAGCTTGGAGAGGG - Intergenic
1052774888 9:32723539-32723561 CTGCTCTGCCTCCGTGGACACGG + Intergenic
1055054106 9:72007974-72007996 CTGCGTGGCTAGCTTGGGCATGG + Intergenic
1056698086 9:88877867-88877889 CTGATCAGCCAGCCGGGGCATGG - Intergenic
1056779807 9:89540968-89540990 TTGCTCTGCCTGCTTGAGCTGGG - Intergenic
1057391878 9:94647207-94647229 GTGCTCTGCCCTCTTGGCCACGG + Intergenic
1057782979 9:98064993-98065015 CTGCCCTGCAACCTGGGGCAGGG + Intronic
1058402798 9:104636937-104636959 CTGCTCTGCTGGCTTGGGTGTGG - Intergenic
1058419490 9:104820573-104820595 GAGCTCTGCAATCTTGGGCAAGG - Intronic
1058642585 9:107101824-107101846 TTTCTCTGACAGCCTGGGCATGG - Intergenic
1059344822 9:113620968-113620990 ATGCTGTGTGAGCTTGGGCAAGG - Intergenic
1059856426 9:118403228-118403250 CTGCTCTGACAGCTTATGCAGGG - Intergenic
1059923817 9:119186500-119186522 CTGCTCTGCCAGCTTGGGCATGG - Intronic
1059928849 9:119240784-119240806 CTCATCTGCCAGCCTTGGCAGGG + Intronic
1060345637 9:122813301-122813323 CTGCACTGCCAGCCTGGGCATGG + Intronic
1060375869 9:123114858-123114880 CTCCTCTGCCGGATTGGGTAGGG - Intronic
1060530875 9:124346476-124346498 CTGCTCTGGCTTCTTGGCCAAGG - Intronic
1060821194 9:126662505-126662527 CTGCTCTCCCAGACTGGGCTGGG - Intronic
1061061597 9:128253388-128253410 CATGTCTGCCAGCTTGGGCGCGG - Intronic
1061289060 9:129640599-129640621 CAGCTCAGCCATCTTGAGCAGGG + Exonic
1062088848 9:134663442-134663464 CAGCCCTGCCAGGTTGGCCAGGG - Intronic
1062320702 9:135989319-135989341 CTGCTCTGCCAGCGTGCTCCAGG + Intergenic
1186517459 X:10176608-10176630 GTCCCCTGCCAGCGTGGGCAGGG - Intronic
1186654970 X:11602580-11602602 TTGCTCTGCCCACCTGGGCATGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1187919247 X:24184986-24185008 CTGCACTCCCAGCCTGGGTAAGG - Intronic
1190330768 X:49233998-49234020 CTGCGTGGCTAGCTTGGGCATGG + Intergenic
1190897695 X:54637545-54637567 CTGGTCTGTCATCTTGTGCAAGG + Intergenic
1191600603 X:63001174-63001196 CTTGTCTGCCAGCTCAGGCATGG + Intergenic
1191740483 X:64432343-64432365 CCCCTCTGTCAGTTTGGGCAAGG - Intergenic
1192262387 X:69513271-69513293 CAGCTCTACCAGCATGTGCAAGG - Intronic
1192759775 X:74085378-74085400 CTGCTCAGCCAGAATGGGCTAGG + Intergenic
1193680960 X:84518555-84518577 CTTCACTACCAGCTTGGGTAGGG + Intergenic
1195610601 X:106862980-106863002 CTGCTCTGCCAGAGAGGCCAAGG + Intronic
1198822628 X:140665319-140665341 CAGCTATGTGAGCTTGGGCAGGG - Intergenic
1199219913 X:145306090-145306112 CTTCTCTGCCAGCTGGTTCAGGG + Intergenic
1200829629 Y:7678355-7678377 CAGCTCTGCCTGCTTGGGAGAGG + Intergenic
1201895250 Y:18985899-18985921 CTGCACTGTCAGCTTTGGAAGGG - Intergenic
1202368155 Y:24180602-24180624 CATGTCTGCCAGGTTGGGCATGG + Intergenic
1202372541 Y:24208580-24208602 CATGTCTGCCAGGTTGGGCATGG - Intergenic
1202498243 Y:25461540-25461562 CATGTCTGCCAGGTTGGGCATGG + Intergenic
1202502630 Y:25489515-25489537 CATGTCTGCCAGGTTGGGCATGG - Intergenic